Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_103809 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Colorectal Cancer | ICD-10 | Malignant neoplasm of rectosigmoid junction (C19) |
DBLink | Link to database | PMID | 28349836 |
Experimental Method | |||
Sample Type | Tissues | Comparison | paired tumor and adjacent non-tumorous tissues from six colorectal cancer patients |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward ACGCATTCTTCGAGACCTCT ReverseTGCCTGTAACTCCTCTTCAGT | Statistics | Fold Change : Downregulated,3.57 pvalue : p<"‰0.0001 |
Citation | |||
Zhang, P, Zuo, Z, Shang, W, Wu, A, Bi, R, Wu, J, Li, S, Sun, X, Jiang, L (2017). Identification of differentially expressed circular RNAs in human colorectal cancer. Tumour Biol., 39, 3:1010428317694546. |