circad | circRNAs associated with diseases

hsa_circRNA_103809
Gene	n/a	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Colorectal Cancer	ICD-10	Malignant neoplasm of rectosigmoid junction (C19)
DBLink	Link to database	PMID	28349836
Experimental Method
Sample Type	Tissues	Comparison	paired tumor and adjacent non-tumorous tissues from six colorectal cancer patients
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ACGCATTCTTCGAGACCTCT Reverse TGCCTGTAACTCCTCTTCAGT	Statistics	Fold Change : Downregulated,3.57 pvalue : p<"�0.0001
Citation
Zhang, P, Zuo, Z, Shang, W, Wu, A, Bi, R, Wu, J, Li, S, Sun, X, Jiang, L (2017). Identification of differentially expressed circular RNAs in human colorectal cancer. Tumour Biol., 39, 3:1010428317694546.